1. Runde 2014

Aufgabenblatt 2013Aufgabenblatt 2014
Download

Aufgabe 1: auf zu neune Ufern (Ökologie)

Die Insel-Biogeographie-Theorie besagt, dass die Anzahl der Arten auf einer Insel von zwei Faktoren bestimmt wird: der Einwanderungsrate neuer Arten auf eine Insel sowie der Aussterberate bereits vorhandener Arten.

  1. Nennen Sie drei Wege, auf denen Organismen vom Festland auf eine Insel einwandern können.


  2. Ordnen Sie den vier durch A1-A4 gekennzeichneten Inseln die vier Kombinationen aus Inselgröße (klein/groß) und Distanz zum Festland (nah / fern) zu. Die Artenzahl der Inseln befindet sich jeweils im Gleichgewicht.



  3. Vergleichen Sie eine Insel weit im Ozean (O) mit einer nahe vor einem Kontinent gelegenen Insel (K) hinsichtlich folgender Parameter: Gesamtartenzahl, Anteil endemischer Arten, Auftreten großer Raubtiere, Zunahme der Amphibienartenzahl mit der Inselfläche, Trend der Reptilien zum Riesenwuchs, Bildung neuer Arten. Verwenden Sie <, =, > zum Vergleich.


  4. Korallengrundeln aus der Familie der Gobiidae leben mit ihrem Partnerfisch zusammen obligat in einer passenden Korallenart und ernähren sich fakultativ von Korallen. Die schuppenlose Haut der Fische ist mit einem giftigen Schleim bedeckt, der Räuber abwehrt und die Parasitenanheftung verhindert. In einem Experiment zeigte sich, dass die Anwesenheit von Grundeln in einem Korallenstock das Beweiden dieses durch obligat korallenfressende Falterfische um 60-90% gegenüber unbewohnten Korallen reduzierte. Begründen Sie, welche interspezifische Beziehung zwischen Grundeln und Nesseltier (Mutualismus, Kommensalismus oder Parasitismus) vorliegt.


  5. Inseln sind oft ein beliebtes Touristenziel. Neben positiven Effekten trägt zunehmender unkontrollierter Tourismus jedoch ein ökologisches Konfliktpotential. Nennen Sie fünf touristisch bedingte Umweltbelastungen und deren Folgen.



Aufgabe 2: Am Puls der Zeit (Physiologie)

Herz-Kreislauferkrankungen sind mit Abstand die häufigste Todesursache in den Industrienationen, obwohl sich zahlreiche Risikofaktoren vermeiden oder reduzieren lassen. Die Herzfrequenz („Puls“) kann als ein Indikator für den Gesundheitsstatus leicht gemessen werden.

  1. Ermitteln Sie bei sich, bei einer mind. fünf Jahre jüngeren und einer mind. 20 Jahre Älteren Person den Puls unter folgenden Bedingungen:

    (1) im Liegen

    (2) im Stehen

    (3) im Verlauf von 5 min nach einer zweiminütigen sportlichen Tätigkeit.

    Protokollieren Sie Ihre Vorgehensweise und Messdaten. Stellen Sie den Verlauf (3) grafisch dar.


  2. Formulieren Sie anhand Ihrer erhobenen Daten eine begründete Einschätzung der sportlichen Fitness Ihrer Probanden.


  3. Stellen Sie aufgrund Ihrer Daten eine Hypothese zur Altersabhängigkeit der Herzfrequenz auf und prüfen Sie diese anhand der Literatur. Erklären Sie den Zusammenhang.


  4. Stellen Sie dar, wie sich mäßige Veränderungen der Routineblutparameter Triglyceride, Gesamtcholesterin und INR sowie der Faktoren Blutdruck, Rauchen und Übergewicht auf das Risiko für Herzkreislauferkrankungen auswirken. Verwenden Sie dabei A für einen gleichgerichteten und B für einen gegensinnigen Zusammenhang der Größen, z. B. für Sport B, da mehr körperliche Aktivität zur Senkung des Risikos führt. Begründen Sie.



Aufgabe 3: Schon ausgeknockt? (Genetik)

Aktuell aus der Forschung: Ein Gen-Knock-out - das vollständige Abschalten eines Gens im Genom - ist ein Werkzeug, um Genfunktionen zu entschlüsseln. Allerdings war die Herstellung eines Gen-Knock-outs vor allem in menschlichen Zellen bisher sehr schwierig. Die Entwicklung von neuen Methoden wie den Transcription Activator-Like Effector Nukleasen (TALENs) verspricht, diese experimentelle Lücke zu schließen. Bei TALENs handelt es sich um Hybridproteine, bei denen ein DNA-bindender Bereich mit einer Endonuklease (Restriktionsenzym) fusioniert ist. Die Endonuklease funktioniert dabei als Dimer und kann deshalb nur aktiv werden, wenn zwei TALENs mit unterschiedlichen DNA-bindenden Bereichen nahe genug beieinander binden.


Die DNA-Bindung der TALENs erfolgt über sogenannte Repeat Variable Diresidues (RVDs). RVDs bestehen aus 34 Aminosäuren und die Aminosäuren an Position 12 und 13 bestimmen, welche Base in der DNA erkannt wird. Es gelten folgende Beziehungen (Einbuchstabencode für die Aminosäuren 12 und 13):

NI = A; NG = T; NN = G; HD = C

Diese einfache Beziehung erlaubt es, TALENs ähnlich einem Primer bei der PCR zusammenzubauen.

  1. Ein TALEN-Paar, das zum Schnitt führt, soll in der nachfolgenden Sequenz vor der ersten Base des Start-Codons angreifen. Die DNA-Bindung erfolgt dabei jeweils mit 15 Basen. Gehen Sie ferner davon aus, dass die beiden Bindungsstellen jeweils genau 5 Basenpaare von der Schnittstelle entfernt sein müssen. Identifizieren Sie den Startcodon und geben Sie die beiden Bindungsstellen (15 Basen) an. Wandeln Sie schließlich die Sequenz der beiden DNA-Bindungsstellen in die entsprechenden Folgen der RVD-Erkennungsmotive (NI, NG, NN oder HD) um.

    5’ - CAGCCAGACTGCCTTCCGGGTCACTGCCATGGA
    GGAGCCGCAGTCAGATCCTAGCGTCGACCCCCTCTGAGTCAGGAAACATTTTCAGACCTAT - 3’


  2. Bei der Konstruktion von TALENs ist das Restriktionsenzym BsaI von entscheidender Bedeutung. Geben Sie die Binde- und Schnittstellen-Sequenz für BsaI und EcoRI an.


  3. Geplant ist, nach PCR und Restriktionsschnitt mittels Ligation für die Konstruktion eines TALENs fünf verschiedene DNA-Sequenzen in einer spezifischen Reihenfolge zusammenzufügen. Durch entsprechendes Primer-Design soll die Generierung von sticky ends an den Enden der PCR-Produkte möglich sein. Beurteilen Sie die Eignung von BsaI und EcoRI für dieses Verfahren.



Aufgabe 4: Nur keine Hemmungen (Mikrobiologie)

Ein spezieller Bakterienstamm wurde genetisch manipuliert und kann Histidin (His) nicht mehr selbst synthetisieren. Diese Bakterien wurden auf verschiedenen Platten und nach verschiedenen Behandlungen inkubiert. Die Ergebnisse sind nachfolgend dargestellt.

  1. Erklären Sie, welche Platten benötigt werden, um den Bedarf der Bakterien für Histidin nachzuweisen.


  2. Ordnen Sie die Platten absteigend nach der Stärke der Mutagenese. Geben Sie für jede Platte an, wie viele Kolonien wahrscheinlich pro Platte auf exogene Mutagenese zurückgeführt werden können.


  3. Die Eignung von fünf Antibiotika zur Bekämpfung dieses Bakterienstammes wurde in zwei Experimenten untersucht. Im ersten Experiment wurden an fünf Stellen gleiche Mengen fünf verschiedener Antibiotika (I-V) auf einen Bakterienrasen aufgetragen (siehe Abbildung). WeiÃße Stellen markieren das Ausbleiben von Bakterienwachstum.

    Im zweiten Experiment wurden die letalen Dosen der fünf Antibiotika (pro kg Körpergewicht) bestimmt. Diese lauten: I = 15 mg; II = 2 mg; III = 80 mg; IV = 60 mg, V = 25 mg.

    Nennen Sie das geeignetste Antibiotikum und begründen Sie Ihre Entscheidung.